>JMCP005H02 269 bp,:Filtered
CACCAAGGATGATGCCATGAAGTGGTTCCAGGTCAAATATGAAGGGGTTATCCTCAACAA
GGCCTCAAACATCTCATAAGTCCAATCTTAGTTTGAGAGAATTTTCAATCAGTTTGTATC
TCCTAGCAATTTTGTGTATTTGCCTTATTATAGACCTACATCTTACTCAGAGTTACTGAG
TTTTGGGTACCAGGATTTGTTGGTAAGTTTATCAAGGTTATCATGACATCTTTGCTGTAG