>JMCP005D04 658 bp,
GTAACATCAAATGCTGGATTCCAAACAGAAATACCCGAAGCAGCGATTTGTTCACCCAGT
CCTCCATGCGTATGCAACAGTTCTTTCGGAGATCTTTCTTCTATCACAATTTGTTGTCCA
GAAGACAAGGAGAGATCAACAGAAGTTAGGGGAGCGGCCACATAAAACGGTACACCATGA
TGCATAGCACAAACAGCAAGGCTGTAAGTCCCGATCTTGTTGGCAGTATCACCATTTGCA
GCTATGCGATCAGCTCCAACAATGACAGCATTCACACGTCCAGCTTTCATCAACGCGGCT
GCAGCAgaATCTGCTATGAGGGTGGCAGGAATGTTCTCGGTAACCAACTCAAATGCTGTC
AGTCTGGATCCCTGGTTGAAAGGGCGTGTTTCAGTGCAATAAGCCCTTTCCAAAAACCCT
GCAGTATTGACAGCCCGAATCACACCAAGAGCAGTTCCATACCCAGCCGTTGCCAGGCTG
CCAGTGTTGCAATGGGTTAATATCGATATCTTCTTGGAGCCCACCAGCTGATTTTGGAGA
AGAGAAGCTCCGTGCGACCCAATTGCTTTATTGGAAGCAACATCATCCTCGAGCATAATT
TCAGCTGCCATAA