>JMCP005C11 659 bp,
ATTCTGCACCTTTGTCTGGATCACCCAAGTCATTGTAGTAGGCATAGTCATACACCCTGT
CCCATTCCTTAAGCTCGCCAGTTCCTGTTCCTCTCAAGTGCACTAATTCTTCATCTCGAT
ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTGGTTTGAAAAGAAGATGC
GCTCGTAGTTGTACTTACTGGCCGGATAAACCCAGGAGAAGCAAGCGAAATGTACTTCGC
CATGATTGGGAACATCTTCAAGGGTTAGGGTTTTGAGGTAGAACTCATTGGGATGATTGT
TCTTGATGATGAATGCTGCCGGAACCCCAAAATCTTCACTCCATTCGAACTCAATTTTGA
ACGCCGACTCGCCGGAGGCTAAAACCGTGTTCTTCAGCACCCAGTGGTCCAAGTATGCTG
CCTCGCTGCGTTTTCCTTTCAATCCATTTCCAAGATCAGCCTGAACGGAGCTGACGAGCT
CTAAGGAGACCTTCTGGCCAAGGAAATCGGAGAGGTTATCAACGATAGAGGCATTGAAGT
CATTGAAGTCCAGGACGTTCTTCCTCATCagCACCACTTTCCCCTTTATCTTCTTCGTCG
GCGACAGCGCC