>JMCP005C08 534 bp,:Filtered
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTC
AACAACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAAC
TACCAGAATATGGAGGAGTTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATT
TTTTTTTTTCTACAAAGTTAAAagaTGATCATGTGACGGagtCCCAAAATCTGCAAATTA
AACACACGACTGGGTGTTTGATTGTGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTT
GATGATGATTAAGCTAAAAAAG