>rJMCP005B12 555 bp,
TAGGCTCCCGGCGAATGATAGTGGCGCCGCCGCCGGTGTTTATTACAATCCGCCGCTGCC
GCCCGGCTCCGCCGCTACTAAGCTTCCCCTCACCAAGGATTACGGGTTCTTAAACAAGGC
AGCGGTGGTAGTAATTGAAGAAGATTTGACCGGCGACGGAAAATGCAGAAACCGGTGGAG
GCTATGCAGCATTCAAGAAACAGAAGAAGTGAAATGCATAGTGCGAGTAATCCCAATCTG
GCCGGCCGGAATCGCCTGCTCGCTCGCCATAATTCAGCAGGGCACCTTCACAATCAACCA
AGCTCTCCAAATGAACCGCCACCTCGGCCGCCGTTTCCAAATCCCGGCCGGCTCCCTCTT
CGTCGTCTCCCTCCTCACCATCGCGGTCTTGCTCCCCTTCTACGACCGCGTCCTCGTCCC
GTGGGCCCGGAAGCGCACGCGCGTCATCGGCGGCATCACCATCCTCCAGaggATGGGCAT
CGGCCTGGCCTTCTCGATCCTCGCCATGgCGGTGTCGGGTTTCGTC