>JMCP004H12 570 bp,:Filtered
GGCCGGGCTCATCTGCGGTGGTTGGACAGATGGACATCAAAGCACCCAAGGAAtcagaGC
TACCAAGTGATCTCTTCatgGCTATAAttgAtCAGTGAAGTATGTAGTACCAAgTGGTTC
CACTTCTTGAACACAGTTTTACAAATTTAGATCAgaTCAGGTCACCCCTTATATATACAT
ATAATATAATATGCTTTTTGCTTGGATTCTTTAGgTGTTTAGAAGTACAGCAAACTAAAA
GACTCCATCTTTTTACAGAGAAAAAAGAAgacgaCACTATAGTGTGGAATTATGGAAGCC
ATTTTTGTCTCCTTCGAGTACAAAAAACTCCATCTTTGTGCTACTTCATCCACCTCTGAA
CCCATCAAAGAAACAAGAAACAAGAAACAAGAAAATCTGGAATGATAGCTAGCTAGTTAC
CAATAAGAATTGCTAAACCCAAACACCCTCTTTTCCCATCTCTCTCTCTCTCTCATCTTT
CTTTATGCGAATCATCACTCAATCAATTGTTCAACAACAGAATTGTTAATGTTCTAGAGA
GAAGTTTAGAAAGGGAGAGAGAGAGAGGAC