>rJMCP004H01 654 bp,
GTAACATCAAATGCTGGATTCCAAACAGAAATACCCGAAGCAGCGATTTGTTCACCCAGT
CCTCCATGCGTATGCAACAGTTCTTTCGGAGATCTTTCTTCTATCACAATTTGTTGTCCA
GAAGACAAGGAGAGATCAACAGAAGTTAGGGGAGCGGCCACATAAAACGGTACACCATGA
TGCATAGCACAAACAGCAAGGCTGTAAGTCCCGATCTTGTTGGCAGTATCACCATTTGCA
GCTATGCGATCAGCTCCAACAATGACAGCATTCACACGTCCAGCTTTCATCAACGCGGCT
GCAGCAGAATCTGCTATGAGGGTGGCAGGAATGTTCTCGGTAACCAACTCAAATGCTGTC
AGTCTGGATCCCTGGTTGAAAGGGCGTGTTTCAGTGCAATAAGCCCTTTCCAAAAACCCT
GCAGTATTGACAGCCCGAATCACACCAAGAGCAGTTCCATACCCAGCCGTTGCCAGGCTG
CCAGTGTTGCAATGGGTTAATATCGATATCTCCTTGGAGCCCACCAGCTGATTTTGGAGA
AGAGAAGCTCCGTGCGACCCAATTGCTTTATTGGAAGCAACATCATCCTCGAGCATAATT
TCAGCTGCC