>rJMCP004G02 617 bp,:Filtered
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTC
AACAACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAAC
TACCAGAATATGGAGGAGTCCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATT
TTCTTTTTTTTCTACAAAGTTAAAAGATGATCATGTGACGGAGTCCCAAAATCTGCAAAT
TAAACACACGACTGGGTGTTTGATTGTGTGTTAAATTATGGTTGTTTAGGGGTGAATATG
TTGATGATGATTAAGCTATAGATTTGTTCATAGGTTATTAATTATCTCCTGTCTCTATAG
TTATATTGTGTGTGAATGAGACCATGAAACTATGGTTTTGTGTCT