>rJMCP004F03 653 bp,
GAGCTCGACGTTAGTGCTGATGGTCCGGCCATTGAGGCGGCCGTTCAGAGGGCTTGGGAT
GCATTTGGGCGGATCGACGCACTGATTAACAATGCCGGCGTTAGAGGTCGAGTACACACT
CCATTGGATCTAACAGAGGAAGAGTGGAATGATCTCACAAAAACAAACCTAACTGGCACA
TGGTTGGTCTCGAAATATGTTTGCTTGCGCATGTGTAACGCTAAGTTTGGAGGATCTATC
GTCAACATCTCTTCCATTTCTGGACTTAACCGTGGGCAGTTGCCAGGAGGCCTTGCCTAT
ACTACTTCAAAGACTGCTGTTAACGCACTCACAAGGGTGATGGCACTTGAATTAGGAACA
AACAAGATAAGAGTGAACTCCATATCGCCAGGGCTCTTCAAATCCGAGATAACGGATGGC
CTCATGCAGAAAGATTGGCTCAATAAGGTTGCTCTCAGGACTGTACCTTTGAGAACATTT
GGCACGTCAAATCCTGCACTGACGTCACTTGTACGTTACTTAGTCCACGACTCCTCTGAA
TATATTTCTGGAAATACTTACATAGTTGACGCTGGAAATACACTGCCTGGTGTGCCTATC
TTCTCCTCTCTTTGAAA