>JMCP004E10 547 bp,:Filtered
CAACAACCGAGAAGAAACCTTCCCCACCACCACCACCGGCGGCGGCGGCGGCAACCGCTA
CAACTACAACAACGGCGGCGCTGCAAACAGGTTTGAGCAGCAAGGGATGAGCGACACAAG
ATTCATGGAAAATGGGAGGTATTACTATGATGTCAACACAGAGAAGTACGCCAGACATCC
ATACGAgaATTCAAGAAACCAGTTCAACAACAATGGAGGATTcgaCAACAACAACAACAA
CAACAATGGATTCATGGAGAACAACTACCagaATATGGAGGAGTTCCAGGACCAagAAGA
CCTTCCCTGAGATTCCTTAACAATTTTTTTTTTTCTACAAAGTTAAAagaTGATCATGTG
ACGGagtCCCAAAATCTGCAAATTAAACACACGACTGGGTGTTTGATTGTGTGTTAAATT
ATGGTTGTTTAGGGGTGAATATGTTGATGATGATTAAGCTATAGATTTGTTCATAGGTTA
TTAATTATCTCCTGTCTCTATAGTTATATTGTGTGTGAATGagaCCATGAAACTATGGTT
TTGTGTC