>JMCP004E01 646 bp,
ACCGCTTTCCTTATAATATTCTCATCTCTCTCTCCTCGTTCGAGTGATTCTGTTTCTGTG
TAAGCTGCACAGTCGCAACGCATTGAGAGCTATAAACTCTTAGAAACAGGAAGATGAAAA
AGCTCTACAGTGCTTCTAAAGATGATAAATTCTTAGAATTTTGGAAGAGAGAGATTGGTT
TCTCGGCTGCCAGAACTTTCTCTCGCCGAATCTCTGCTTCCGAGGCTGTGGTGAAGCAAC
TTGATTTGTATGGGAAATTAAATGGTCATCAGGGATGTGTTAACACAATCAACTTCAACT
CCACCGGTGATATTCTGGTGTCTGGCTCTGATGACAAACAAGTAATTTTGTGGGACTGGG
CCACAAAGACATCAAAATTGTCATATCCATCAGGTCACTTGGATAACATCTTCCAGGCCA
AGTTCATGCCATTCACTGATGATCGTAAAATAGTCACTGCATCTGCTGATGGCCAGGTCA
GGCTTGGCCAAGTGCTGGAGAATGGTGAGGTAGACACAAAAAGGCTGGGAAAGCATCAAG
GTCGAGTACACAGTCTTGCTGTGGAACCAGGGAGCCCCTACATATTTTACAGCTGCGGTG
AagatggttTTgttaaaCATTATGATCTAC