>JMCP004D11 643 bp,
AGGTCTAGAAACATCATATCTGATAAAAAACATGGTAGTAGATGGATCATGGAGTAGCCA
AGGCCACCATTCCATTTTAATTTGAAAGAAACAATCTTTTTGGTAGAACAGTACAGTTGT
ACCTTCTGATTGTTAAAATTGGTCATAATTATCATAGGCCAATTAAGTCAAGACTCAAGC
GGAGCAATAATGTTTAATTTGTTGATATCATGAACATTAGCATTGTGTGAATTGATCAAC
TTCTATATATGATCTATCTCATCTAAATAATCATGTTAAGATGATCTGAACATCTAACCA
GTAGTACTATCAGATAGATGCATTAAAACTTCAAAACTTAAATTTAATTTGTATCATTAA
AAGAGTCCCTAAAATTACCTCCTCCGTTCCAAATATTAGCTTCGCTGCTTGACAGTGAAT
GGGTGAGTGTAAATGAAGAATAAAATGTTTTCCTTTTCTTATCTTAAGATAATAGAGAGA
GATAATTCATGCATGCCTCGAGGTAACTTTAGGAGTGGAAAATAACATTTTAACAATTAT
GAAAAACGACAAAGACCTAGTAAATTAACATCATTACATGTTGGACTGCCACATAAATAA
CATGTCCCTGTAAATCA