>JMCP004C09 607 bp,
CTCTCAGCTCCGGATTTCAGTTTGATCGCCGAACTGAGAATTCCACCGCCGGCGGCCCAA
AATGGTGCACGTCAACTTTTACCGGAACTATGGGAAGACATTTAAGAAGCCTCGTAGGCC
ATATGAGAAAGAGCGATTGGATGCTGAGTTGAAGCTTGTTGGTGAGTATGGACTTAGGTG
CAAGAGGGAACTCTGGAGGGTTCAGTATGCATTGAGCCGTATCAGGAATAACGCAAGAAT
GCTTCTCACACTCGATGAGAAGGACCCAAGGCGTATTTTTGAGGGTGATGCCCTTTTGAG
AAGGATGAACAGGTATGGCTTGCTTGATGAGAGTCAGAACAAGCTTGATTATGTCCTTGC
CCTAACTGTGGAGAACTTCCTTGAGCGCCGTCTCCAAACTCTTGTGTTCAAGGCTGGCAT
GGCAAAGTCAATCCATCATGCTAGGGTGCTCATTAGGCAAAAGCACATCAGGGTTGGAAG
GCAGGTTGTGAACGTCCCCTCCTTCTTGGTCAGAGTGGACTCGCAGAAGCACATTGATTT
CTCACTGTCCAGTCCTTTTGGTGGCGGTCGCCCTGgtagggtGAAGCGAAAG