>JMCP004C06 411 bp,:Filtered
AACGCAGAGTTCATGCAGACCTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCAAG
AGGCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGG
TTGAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAG
GGATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACT
GTTGCAGCTGTTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAG
TTCTGTAAGATATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAACATACT
ATGCAAGTGTATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCGCC