>JMCP004A12 413 bp,:Filtered
AACGCAGAGTTCATGCAGACTTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCAAG
AGGCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGG
TTGAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAG
GGATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACT
GTTGCAGCTGTTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAG
TTCTGTAAGATATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAACATACT
ATGCAAGTGTATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCGTCGG