>JMCP004A07 639 bp,
CCCTTAAATACCGTGGAAGCATGTGGGGATATAAAAGATTTTTCAAAAGAACGGTTCTTG
AATCGTCGGACTACCTGAAAGATGATTGCCTTCAAATTCATTGTTGTGTTGGGGTTGTTA
GGTCTCGGACCGAGGGGCCTAAGACCTACGCTATATCTGTACCGCCATCAGACATTGGCT
TGCACTTTGGGCAGCTTCTGGAAAGTGGAAAGGGGACTGATGTGAACTTTGAAGTTAATG
GAGAGACCTTTGCAGCTCACAAGTTGGTACTTTCTGCCCGGTCACCGGTGTTTAGAGCAC
AACTTTTTGGTCCAATGAAGGATCAAAACATGAGCATTAATGTTGAAGATATGGAGGCCC
CTGTTTTTAAGGCTCTCCTGCATTTTATATACTGTGATGTGTTGCCTGATATGGAAGAAC
TTACGGGTATGAACTCAATGTGGGCTTCAACCTTGATGGCTCAGCATCTACTCGCAGCTT
CTGATCGGTATGGTTTAGACAGGCTTAGGTTGCTCTGTGAGGCTAATTTGTGCGAGGACG
TGACCATTAATACTGTTGCCACAACTTTAGCCTTAGCTGAACAACACCATTGCTTCCAGC
TGAAGTCTGTCTGTCTCAA