>JMCP004A06 195 bp,:Filtered
AATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTGAAAGCTTGAATT
CAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAGGCCTTGTGTTTCATG
AGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAAAGTTCTTTGTTT
C