>JMCP003H08 655 bp,
TTTCATAATAGATATCACATGATTACTTGGATGTGTTGATTTGTAACCACAAATTTTCTC
TGAAGACATTGACTTTCCACTAGATTCCCTGGATTCCACTTCTGAAAGTTCTTCAATATG
TCGTTTCGTAGGTTTACGAACCCTTTTAGCTGCAGTTTGTTCCATGTTATGGCCCTCACT
AACAATACAACCTTCCAATGTTGAGTTGGGTATATTCCCTTCAGTAATATTAGCTGGACT
CTCTACTTTGTCATCATGGCCAGATGAACTTCCTGAGTCAATATTTGGCAATGCAACTAT
GGGATCTTTTGAAATCGAACCATTCACACTTGCAATGTTTTCTTTAACTTTCTTCACCAC
TCTGCTGTCCTCAATAACAAAACTAGTACAAGAAAAATCACATGAATTTGACAACCCCAT
GGAAATCCTCCTCTTAAGCCATTGCTTGTCCTTAACTGAAGTATCTCTTCCAAAGGTTGC
TTTAAAAGTTTCATGAAGTTCTTTTACTGTTAAATTCTCCAAACATATTTCCCCCTTCAA
CTTAGAAAAATcaggCTTCCAGCTAGCCCCAGCTTTGGAAGCCAATAAATTATTCTCACT
AAATGCATC
>rJMCP003H08 238 bp,:Filtered
TCGACGGCGGGCTTGCCAAGAAAGGCCTGAATCTCGATCTTAACCTGGCTCCACCCATGG
AATCTTAACGAAGAAAAATTGATTTTTGTGAAACTAATTACTTATTTTCCTGTATATAAA
TCTAGATTCGGATGACTGTTCTTTTTCATGGCTCAGTTATGAGAAATGTCGCAGCTTTCT
CTCGCTGTTTCGCGTTGTAACTCTTAGGATTTTCTTG