>JMCP003H05 647 bp,
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTC
AACAACAATGGAGGATTCGACAACAACAACAACAACAACGATGGATTCATGGAGAACAAC
TACCAGAATATGGAGGAGTTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATT
TTTTTTTTTTCTACAAAGTTAAAagaTGATCATgTGACggagtCCCAAAATCTGCAAATT
AAACACAcgactgGGTGTTTGATTgtgTGTTAAATTATGGTTGTTTAGGGGTGAATaTGT
TGATGATGATTAAGCTaTagaTTTGTTCATAGGTTATTAATTATCTCCTgTctctaTAGT
TATAttgtgtgtgaAtgagaccATGAAACTATGGTTttgtgtCAACTGGTctagaccAAA
TCTATATATTAAACT