>JMCP003G11 588 bp,:Filtered
GAGGTACGTGGGAGCTGCGGAGGTGGCAATGCATATGTCTGACAACTTAGCATTCTTTTC
GGGGGAATCATTAACATGAGTCAAAGTTTGGCTCAACCGGGTGTCTCCCAGGTTGTTCTT
GAGGACTTGGTGTAGGTATTTGCCGTcGTACTTGGGGCCTGCCAACATGTTTTGCCACGC
CGATGTGTTTCCTGGAAAGATATATGGTCCGTGCTCCTTGTAGAAAGGGACGATATCCTT
GCCGGCGTAGAGGGGGCGCTTGTTCTTGTCCGGCGCCGCTAACATGGTGGTCATCAGTCC
TCCGGTGCTCGTTCCGGCAATCACATCGAAGTAGTCCGCTATTCTTGCATCCGGACCGTC
AAAAGCTTGAAGCTGCTCTTCAAGGTAAGCGACAATGGTGCCGGGGATGATGCCACGGAT
GCCACCTCCATCAATGCTAAGGATGGTGACAACGCCGCTGGGAGGGATGGACGCAGCAAT
GTACCCTCCGGTGGCGGGGGACGATGGGGTTGTCTGGCTGTTTCCCATTTCAAAGGATTG
GTATGATATAC