>JMCP003G08 427 bp,:Filtered
TCATGCAGACTTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCAAGAGGCTGGACC
ATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTTGAAAGAAA
AACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGGGATACTACA
AGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTGTTGCAGCTG
TTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAGTTCTGTAAGA
TATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAGCATACTATGCAAGTGT
ATTCACTATTAGATTTCATCAATCTATTTCTCAATTTCGT