>JMCP003G07 601 bp,:Filtered
GGGATGACCTATAACAAAGCGTTATACTTAGCGATCCTGTAATTACACACATTGAAAGCA
ACTTTCTAGATTTTGAATTAAAACCGAAAGATGTACCTCATGTAAAACAAGATATATGCG
CCTTCTGTCATAACTCGGCTCATAGGTACTTGCTCAACCTGTCATTTTGATAAACCCGTT
TTACCAGACAGTAAGCTTAAAGCACACATTAAAAGCAACTTTCATATTCCTTTTTCCTCG
TTTAATTTGCCCAATTATTAGAGTTCAGTTTGGATTTTACCTCGACAATTACTGAAACAA
AAACAATACAATTTTATGTAGAACTTTACCTTGGTATCATCAATCCTGAACCAATTGCCT
TGCATATCTTTCACATAGGATATATAATGCCCCGAAAATGACGCATTTAGTGTATCTAAG
TGGACGACGACAGCATAAAGCATGTAAAGCGGAGGTACATCATCGGTCCCGGTCATATAT
GGTATCATATCCAGCATTTCGGGGAAAGTAATGCACTTGTTTATCTTGCCATAACACCCA
CCCTGACAATCATAGTAG