>JMCP003G02 259 bp,:Filtered
GTTTCAGGATCGTGAGGAATAGAGTGGCGCAGACGGCGGCGATGACGATGGCGATCAAAA
GCAGAGCGGTAGTGAAGCAACAGATTTTTCGACTTTTTGGAGCTGTAATTTCCATGGTGT
TTTGAGAATTTTTATCAATGATAATCAATTTTAATGATGAAACTTGTATTTATGTTTTTA
TATATAAATAGATATACGCCTCTTCATCTTATCG