>JMCP003G01 211 bp,:Filtered
TGCACCTTGCAAGGTGGACCGAAGTCCAAAACAATTCTGCCATTTGAAATAACGGTGCCA
CACCGCTTCCTCAACCAATGATATAATTTTCAGAGTTCTTTAACTGTGCATATAGAGTTA
TGAAATTGTAAATATAGAGTCCTGTAATTGTGAATATAGCTCAAAAAAGACAACTACG