>JMCP003F06 642 bp,
CCGCCATGGCTCAATTCAATGCAGCTTTCTCCCTCCTCATTACCATTTTCTCTCTCTTCT
CCCTCGCTTCCCCTCGCGCCATCTCTCCGCAAACCCAAGTCCTCGACGTCTCCTCTGCCA
TCCAGAACACTCTCCACGCCCTGTCGCCCACTTTCCGAGACCAAAAGAAGAGTTCAAATT
CTTCTTCTTCTTCTTCTTCTTCGTTTTCCCTGTCGGTTCATCCCCGGAGCTCTCTGGTGA
GGCCGCACCAGCGGGACTATGGAGATCTTATGGCGGCCCGGGTTGCTCGGGACGCTGTTC
GGGTGGCCTCGCTGGATGCGAAGCTTATGGTTGCGGTGTCCGGGTTGAGCCCGGCGGATC
TCAAGCCGGTTCAGACGGTGGTTCAGCCGGAGGATTTGGAGAGTCCGGTGACGTCGGGGG
TGAGTCAGGGGAGTGGGGAGTATTTTGCCCGGTTGGGTGTGGGTCAACCCGCTAAGGACT
TTTACATGGTGATTGATACTGGGAGTGATGTGACTTGGCTCCAGTGTCAGCCTTGCTCGG
ATTGTTACTCCCAAACCGACCCGATTTTCAACCCGGCTCAGTCGTCGTCGTACCGCCGCG
TCTCCT
>rJMCP003F06 640 bp,
CTCTCAGCTCCGGATTTCAGTTTGATCGCCGAACTGAGAATTCCACCGCCGGCGGCCCAA
AATGGTGCACGTCAACTTTTACCGGAACTATGGGAAGACATTTAAGAAGCCTCGTAGGCC
ATATGAGAAAGAGCGATTGGATGCTGAGTTGAAGCTTGTTGGTGAGTATGGACTTAGGTG
CAAGAGGGAACTCTGGAGGGTTCAGTATGCATTGAGCCGTATCAGGAATAACGCAAGAAT
GCTTCTCACACTCGATGAGAAGGACCCAAGGCGTATTTTTGAGGGTGATGCCCTTTTGAG
AAGGATGAACAGGTATGGCTTGCTTGATGAGAGCCAGAACAAGCTTGATTATGTCCTTGC
CCTAACTGTGGAGAACTTCCTTGAGCGCCGTCTCCAAACTCTTGTGTTCAAGGCTGGCAT
GGCAAAGTCAATCCATCATGCTAGGGTGCTCATTAGGCAAAAGCACATCAGGGTTGGAAG
GCAGGTTGTGAACGTCCCCTCCTTCTTGGTCAGAGTGGACTCGCAGAAGCACATTGATTT
CTCACTGTCCAGTCCTTTTGGTGGCGGTCGCCCTGGTAGGGTGAAGCGAAAGAACCAGAA
GGCAGCTGCCAAGAAGGCTGCTGGC