>JMCP003F01 275 bp,:Filtered
CATGCGGGCGCGTGCTATGGATGGACATTTCAGTACTCGGTTATGAAACCTGGGATGAAC
GACGTCGAGGTTTTCACTGTTCTCCCGGAAACCAGGTCTGTTCGATGAAGATCGATGCTT
CATGTATCCTTAACATGGTGTATATGTCTGTGAAGTCTACTGCAAATCAAAGTATAGAAC
AAATGTGATGAACATTTTCTTGTCACCTCCCAACTTAATCATTAAGTGACGGTATTGATT
G
>rJMCP003F01 643 bp,
ACAGCCACCATATCTGCTGGATCTGAAGCTCAGGAGCAATTGCGTTTGAACTAGCCACAA
CTATAGTGCATTGCGCCGCACCCGTTGCTGCGAGCTGAAACGATGTCGTTTGAAGAGGAC
GAGGAGTCGTTCGAGCACACGCTCCTGGTGGTGCGTGAGGTGTCGGTTTTCAAAATCCCG
CCGCGCCCCACCAGCGGCGGCTACAAGTGCGGAGAGTGGCTTCAGTCCGACAAGGTCTGG
TCCGGCCGCCTCCGGGTGGTGTCCTGCAAGGAACGCTGCGAGATCCGGCTCGAGGATCCC
AACTCCGGCGAGCTCTTTGCTGCTTGCTTCGTGCATCCCGGCCAGCGGGAGAGCTCCGTC
GAGTCGGTTCTCGACTCTTCCAGGTACTTCGTGCTGAAGATCGAGGATGGCCGCGGCAAG
CACGCGTTCATCGGGCTAGGGTTTAACGAGAGAAACGAGGCTTTCGATTTCAATGTGGCA
TTGTCGGATCACGACAAGTACGTAAAGAGAGACCACGAGAAGGAGGCCGGCGATGGTCAG
ACCAGTGATGAGAATAGTCATACTGACGTTCATCCAGCTGTAAATCACCGCTTAAAGGAA
GGAGAAACCATAAGGATAAATGTAA