>JMCP003E09 625 bp,:Filtered
GTGTCCTGGCAGGGGAAAATGGACCTGGCGTGGATGGACTGACATTGGGTGTAAACAAAC
GGGTGGGTTTTGTTAAAAGTTTGCGGCGGCGAAAGCCACTGGAGAGCTGAGCTAGAGGGG
CTCGTTTTCGAGAGCACCAACACCTGAGCTTGGCCCGAAAGTGAGACGGTGACTGATTGC
CCGATCACTGGGTCCGGCAGGGACGGAGAAAGGGAGAAGGGGAGCGGCGAAAGTGAAACT
GGGTCGAGAACGGCGGAGATGGAGAGGGAACGGGTGTCAAGAGTGAGGTCGCCGGAATAA
GGGGCGGCGAGGGAGAGGAGAGTCGCAGCAGAGATAGTTGAGGACGGGAAATCAAAGTAG
AGAGTAAGGGAGATATGGACAGTGAAGGGATGAGCAGAGTCCGTGAAAGAATGGGGATCA
ACGGGCGCCATGACTTCGGTTTTGCAAGGACTTCTACACAAAACTGGATTTTTGGAGTAG
CGAAGAAGACGATTGCTTTTTTCTAAAATTTACCGTCTTGGAGGGTCAAGACCGCAGATG
CATAAATATATGAGATTTGAGAATAATTGACACTTCCTCG