>JMCP003D12 493 bp,
TGTGTGTCCACGCAAAACTGAAATaggcaaCCcATCTGGCAAGCGCCACTGGAATATagA
agaTTAcaTAATTTACTATTAAAATAAAGAGAGCTGAaccatTATATTTCTTTTAaagat
taaTACGCAAcCTGTGGTGTTGAATTaggCagATCCCTACTTTCTAtaaTAAAgcatGGA
ACTAAATctgATTTTAATCCTCaaaCTATGGTGGTATTCCCTCTCAGtACCCTACTATCA
ATTTTTAcaAATAATCCCCCACCTACAGAGAAGTGGATAGAAAAGGTCCTTTGTTAGGGT
CCTTTATTAAACCTAATAGaGGACTGGATTTATCAAgTTTTTAATAGTTGGGGAATTATT
ATTGTCCAATTTCagTCCAgcAATAGTCTCTGATGCTTAAAAATTAGaCAAAAATGGTTC
ACCATTCtaATGTTCTTGGGGGATTACTTTTTGTCGAAATTGATAGTTGGATAATAAAAG
TGAAATACCACTC
>rJMCP003D12 642 bp,
CTCTCAGCTCCGGATTTCAGTTTGATCGCCGAACTGAGAATTCCACCGCCGGCGGCCCAA
AATGGTGCACGTCAACTTTTACCGGAACTATGGGAAGACATTTAAGAAGCCTCGTAGGCC
ATATGAGAAAGAGCGATTGGATGCTGAGTTGAAGCTTGTTGGTGAGTATGGACTTAGGTG
CAAGAGGAACTCTGGAGGGTTCAGTATGCATTGAGCCGTATCAGGAATAACGCAAGAATG
CTTCTCACACTCGATGAGAAGGACCCAAGGCGTATTTTTGAGGGTGATGCCCTTTTGAGA
AGGATGAACAGGTATGGCTTGCTTGATGAGAGTCAGAACAAGCTTGATTATGTCCTTGCC
CTAACTGTGGAGAACTTCCTTGAGCGCCGTCTCCAAACTCTTGTGTTCAAGGCTGGCATG
GCAAAGTCAATCCATCATGCTAGGGTGCTCATTAGGCAAAAGCACATCAGGGTTGGAAGG
CAGGTTGTGAACGTCCCCTCCTTCTTGGTCAGAGTGGACTCGCAGAAGCACATTGATTTC
TCACTGTCCAGTCCTTTTGGTGGCGGTCGCCCTGGTAGGGTGAAGCGAAAGAACCAGAAG
GCAGCTGCCAAGAAGGCTGCTGGCGGC