>JMCP003D05 593 bp,:Filtered
TTTAacaGAGgAaGACCTCGACGCTGGAACTTCTAACGGAGAGGCAAAGCGGGCACGCCT
GagCCACCGCATCGCaggCGGAGCagaGGCAAAGATGGCGGcaCGGCAACACCACCACGG
AGGCGATTCGCTTACGGCACGCCTTGCAGCTCGGCCCGGGAGACAAAACTACTCGGTCCG
GGTCAATGTaggCCGACTCCGCATCCTCCGCGTCTCcACCGGCGCcGCATGCCGGCGCGT
TTCcgTCTTCCCTCTCCTGGACGGCGCcggCGTTCATGATCACCTGCTgtagcTGagcTT
GCAGcgtCGCcgcCGTGACTTCCTGCGCCCTGGCTCTCGCCTGCCACGCCTGCGCCTCCG
CGCTCAGCTGCTGCGCGCGGGCGTGCAGCTCCGAGTTCCGCCTCGCCGCCTTCTCCACCT
CCGCCTCTTTCTCCCTCAGCTTCCGCGCCACCGATTCCTCCGCCGCTCCCAGCAGCGCGC
GGTAGTGCCTCTGCCGTTTCTCCTCCAATGTCCGCCTCAATTGATCTCCCTATACACACA
CACACG
>rJMCP003D05 630 bp,
CCATCACGGACCGGaGCTCcgGAGCTCACCCCGCCGTACTCTCTCTCTCTCTCTCTCACC
AGTCACCATTACACGAAACCCTAACCGTCACGTGTTCCGGAAATACCTCCGTCCAGTTAC
CTATCATCGTTGTCTGTTCCTCCGCTACACCCCCAATCACACCTGCTTCCAGAAATCCTG
TCCGTCCATTTCAGCCGCACATTGTTGTGTGCAAAACTGCTTTTTATAGaagGCCTTGAG
TAGATACCAATTTTTCTATATCTGTATCTGTTGGTATATGCATTTATAGGGTTGGTGGTG
ACAAGGATGGGGGCGATGACGTCGTCGGTGGCGGCACGGTTTGCGTTTTTTCCGCCGAAT
CCGCCGTCTTATGAGGTGGTTTTGGAAGGATCCGCCGCGAAATTGAAGATGACGGAGGTg
GAGGAGAGGGAGAACGTGGATGTGCTGAAGCTGGCTACCAAGAGAGGGACGGAAATTGTG
GCGGTTTACGTCAGGAATCCGGCGGCGAAGCTAACTCTGCTATACTCCCACGGCAACGCT
GCTGATCTGGGTCAGATGTAcgAGCTGTTCTGTGAATTAAGTCGTCATCTCCGCGTCAAT
CTGATGGGGTATGATTATTCAGGGTATGGA