>JMCP003C08 214 bp,:Filtered
AATTGTCAGAGGCTTTCTTGAGTTGGAGTCCATTGGAAATGTTATTTGAAAGCTTGAATT
CAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTGCAGAGAAGCCTTGTGTTTCATG
AGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAATAAAGTTCTTTGTTT
CGATTC