>JMCP003C06 462 bp,:Filtered
TACACCAACGGCGGCGAGAATTACTTCAACAACCAGAAGGAGAGGTACCCCTCCGCCACC
ACCACCACCGGCAACCGGAATGATCAGTACAACGGCGGCGATGCTAATGGAGGATTCAAG
AAACAGGGGATGAGTGACACCAGATTCTTGGACGGTGGGTGATATTATAACAACGGCGAG
AGGTTCCCCAGAAACCCATTGGACAATTCAAGAAACCAGTTTGGAAACAGCAGGTATTTC
AACGAAAACAACAACAATTTCATGGAGAACAGCTACCAAAATGAGGAGGAGTTCGAAGAT
GAAGATGATGATGATTTGCCCTGAGGAACACTTCCTAGCTCTTTAATTTGCAGAACATAT
AAATGTTATTATTTATCTTTCATGTTCGCAACTGTTGGGTATAAGTGATTAAGATTGTCG
ATCTTGTTGAG