>JMCP003B11 247 bp,:Filtered
TGGAGATTGCAAGAACGGCTGCTCATACAAGGGGGAGAGCGTGGATGCAACAAAGCCTTA
AGCCTCAGCACTATATACCCACTCCGTACATGCATATGAATATGATCGAATTGGCAATCT
GTAATAATGCATGCAGTCATGAAGTACCACTTACACTTACTTCTCTGCAATATCTTTATC
ATAAATAAATGAATTGGTTGCCCC