>JMCP003B06 252 bp,:Filtered
CACCAAGGATGATGCCATGAAGTGGTTCCAGGTCAAATATGAAGGGGTTATCCTCAACAA
GGCCTCAAACATCTCATAAGTCCAATCTTAGTTTGAGAGAATTTTCAATCAGTTTGTATC
TCCTAGCAATTTTGTGTATTTGCCTTATTATAGACCTACATCTTACTCAGAGTTACTGAG
TTTTGGGTACCAGGATTTGTTGGTAAGTTTATCAAGGTTATCAC