>JMCP003A06 644 bp,
ATGTCTGTCCTGAAGAGGTGCCCAAATTCGAGGGACCTGAAACTCCAGGAAATATCTCAG
CTCTTCAAGTTGAGGCTTGTCTGCAAACAACGATATCAGAATAAATAGCCGCCAATGTAA
CAGTTGCTTAGTGTTTCGATGGAATAAAAAAGGGGGAGAACGGACTTCTGTGTTACAATA
TCCTTACATTCAAGATAGAGACTTATAGCACGAGACAAATGCTCCTTTCCTTTAACTCCC
TCGAGGAGCATTGTAATCGGATAGAATGACATCTCGATGACATCGGGTGAAGACTTGACT
GTTTTTGCCCAATGAACGTGGCTTTGCTCCAGATCGTCTCCTCCCCTTCTTCTGAAAATG
ACTGTAACGTCCTGCATTAGATCCATCAAAAATTTCAGGCCTAACAGCAGGAAAGAAACT
TTTAGTTTCCATTAAGTCACTGCACTTAGTTAATAACATAATTATATACCAAGTCACATG
CATTTCGTTTTTTGTTGTCAGaCCACGAGGTGTCCTGAGCAGGTCCTAACTGTAGGAGAC
ACCTTTAAGCCCGTACCATACTCAACTAATCCCCGTTCGCACCGGGCcGgccCAATTAA