>JMCP003A05 368 bp,:Filtered:PolyA
GGGTTATTGTTGTTAAGGTGATGGGAAGAGTCTTCTTCACCATTCTCCTTCGCCAAAGAT
TTCTCAATCGCAGCATCCATATTTTATTTACAGAACAAAAAGAATGATAATCAAGAAGCT
TCAGTAATGGTGGCTTATATGGGGAGTTCGGCTTATATGTCCATAGCTTAGCGTTTCAAC
AGAGAGAGAGAGAGAGAGAGAGAGAAAGAGGAGAGAGAGAAGACCAGAGGAGAAGAAAAG
AGAAACCAGTCGCcatGGAACGTCATCAACATCTACTCTGAAAaCTGCCCCACCTTCAGA
AGCCCATAGAAAATTTCAAACCC