>JMCP003A04 654 bp,
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCAAAC
AGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTACTAT
GATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTCAAC
AACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAACTAC
CAGAATATGGAGGAGTTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATTTTT
TTTTTCTACAAAGTTAAAAGATGATCATGTGACGGAGTCCCAAAATCTGCAAATTAAACA
CACGACTGGGTGTTTGATTGTGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTTGATG
ATGATTAAGCTATAGATTTGTTCATAGGTTATTAATTATCTCCTGTCTCTATAGTTATAT
TgtgTGTGAATGAGACCATGAAACTATGGTTTTGTGTCAACTGGTCTAgaCCAAATCTAT
ATATTAAACTCGACAGATGATG