>JMCP002H10 627 bp,
CAGTGACCAATAATTATGTTAACAACGTTGGAAGGAAACAAAGGACTTGTCGGTCGGTCA
CAGTTTGCACGTTTTTTTATTTCAGATCCAGAGGTGAAAGTGTGAAACTGTGAAAGATAT
ACACATTATAATAATTTACTATATAAAGCCATAAAAGTTAGaGAAGACGACATAGCAGGC
CAATACAGAGATcgaagaTGAGTTTTTATTTTTTGGGGGCCGGGGAATATTTGTACATGC
AGTTGTGTATATATGCTGGAAAAGCTTTGTAGCGCTGTAGCCTGTAGGACTTGTCTTCTC
GCACGTGCTGTCAAGCTTCAAACTTTGGTGATTTGAGATGAACCTTTACTTTGGACCAAC
GTCATTGTTTTGGGTCTTAACACTGCCTATTGGGCATTGTTGCGGACTTGGCTCGTCACA
CTCAGGCCCAAGTAGCCTTTTTTTTTTCCTCAACTTTGTTCGCCAGGGGCAAATTATATC
gtgCACCAGGGTGCACTGCGTCCTagcCCAAAAcgatgaTGTTAAGTCTTTAAAAAAAAT
TATGTTTCAAATGTATAAAATTTTATACCTAAAAACATAAAATTTTTA