>JMCP002H06 641 bp,
CCTCGGCCGCCGTTTCCAAATCCCGGCCGGCTCCCTCTTCGTCGTCTCCCTCCTCACCAT
CGCGGTCTTGCTCCCCTTCTACGACCGCGTCCTCGTCCCGTGGGCCCGGAAGCGCACGCG
CGTCATCGGCGGCATCACCATCCTCCagaGGATGGGCATCGGCCTGGCCTTCTCGATCCT
CGCCATGGCGGTGTCGGGTTTCGTCGAGATCAAGCGACGCGCCGCCGCGAACGGCGGCGC
GTCGCCCCTCTCCGTGGCGTGGCTGTTCCCGCAGCTCATGGTGATGGGCTTCGCCGAGGC
GTTCAACATCCTGGGACAGATCGAGTTCTACAACAAGGAGTTCCCGGAGAACATGAACAG
CATCGGAAACTCACTGGTCTCCGTCACGTGGGGCGTCGCCGGTTACGTGAGCACCATGCT
GGTCAACACGGTGCACAAGACCACGGGGGTCCACGGCCGGCCGGACTGGCTAAACGACGA
CATTAACGCCGGCAGGCTGGAAAATTTCTACTTTGTTATCGCCGGCATGGGAGTCGTGAA
TTTAGTGTACTTTATGGTCGTTGCTCGGAGATACCGCTACAAGAGCAAAGTGTGGGTTGA
T