>JMCP002G12 635 bp,
ATCAAGCTGGTCAGGATGAAAAACCTCCATTACTGCTGAAAAGCCATGGAGGTCCTACAG
CTGAGGCGAGGGGAAGTTTGAATCTTagtATTCAATATTGGACTAGTCGTGGCTGGGCAC
TTGTGGATGTGAACTATGGTGGAAGCACTGGTTATGGCAGAGAATTCCGAGAGAGGCTCT
TGAGGAACTGGGGAATAGTTGATGTTAATGACTGTTGCAGTTGTGCTAAGTTTTTGGTTG
ATAGTGGAAGGGTTGATGGTGAGCGGTTATGTATCACGGGAAGTTCAGcTGGCGGGTACA
CTACATTAGCAGCACTTGCATTCAAAGATGTATTCAAAGCTGGTTGTTCCTTATATGGTA
TAGGCGACCTGAAATTGCTGGTTGATGGAATGCCCAAGTTTGAATCTCACTATATCGACA
ATCTTGTTGGAGATAAAAATGCATACTTTGAGAGGTCTCCCATCAATTTTGTGGACAAAT
TTTCATGCCCCATAATTTTATTTCAAGGATTGGATGACAAGGTTGTCCCCCCAGAGCAAG
CACGCAAAATCTACCAAGCACTGAAGGCAAAAGGTTTACCTGTTGCCCTGGTGGAATATG
AA