>JMCP002G10 559 bp,
GTTCAGGAGAGCGAAGTGCTTTGATCCTTTACCGATTGTTCCAGAAGAACCTTTTTGAGA
CTCTTTAATTTCTTTTTTTCCATAAACAAAAATTcaacGAGAAGCTCGTAAAATGGGGAA
CTTAAAGGCGATGGTTACGGACGATTCCGACACCGTTTCGGACGATGACGGCGCcacCAC
TGTTACTGACTCGCCATCGTCATCGCCGCCTCCACATTCGTCATCCCTCTCCGGCCCCTT
CGAagaAGGAGAAGAAGTCCTTGCTTATCACAACCAATGTGTGTACAAAGCTAagaTTCA
AAAGACTCGATTTGTGAAGGCAGAATGGGAGTATTTTGTTCACTATACCGGTTGGAACAA
AAACTGGGATGAATGGTTGGGCATAGATCGATTGATGAAAGTCACTGAGGAGAACTTACG
AAAACAGCAGGAGCTTAATAATAAATATGACATGAAGAAGAACGAAAAGGCCAGGCGTGG
ATCACAATTAAAAGCAAAATGTTCTACTGGGACAAGAGCTAAAAGGCAAAAGAAAGATGT
TCAAAAGGACAAAGGTGTC