>rJMCP002G08 657 bp,:mask_remained
cagaGTGGCCATTGAGCTCGACGTTAGTGCTGATGGTCCGGCCATTGAGGCGGCCGTTCA
GAGGGCTTGGGATGCATTTGGGCGGATCGACGCACTGATTAACAATGCCGGCGTTAGAGG
TCGAGTACACACTCCATTGGATCTAACAGAGGAAGAGTGGAATGATCTCACAAAAACAAA
CCTAACTGGCACATGGTTGGTCTCGAAATATGTTTGCTTGcgcATGTGTAACGCTAAgTT
TGGAGGATCTATCGTCAACATCTCTTCCATTTCTGGACTTAACCGTGGGCAGTTGCCAGG
AGGCCTTGCCTATACTACTTcaAAGACTGCTGTTAACGCACTCACAAGGGTGATGGCACT
TGAATTAGgAACAAACAAGATAAGAGTGAACTCCATATCGCCAGGGCTCTTCAAATCcga
GATAACGGATGGCCTCATGCagaAAGATTGGCTCAATAAGGTTGCTCTCAGGACTGTACC
TTTGAGAACATTTGGCACGTCAAATCCTGCACTGACGTCACTTGTACGTTACTTAATCCA
CGACTCCTCTGAATATATTTCTGGAAATACTTAC