>JMCP002G06 532 bp,:Filtered
TTTGATTTAAAGCGAAAGCGCAAAGCAAAGCGTCACTTTTTCAAACAAAACGAAGCAAGT
CACTTTTTTACGCAAAGTGATGCTTTTCCAAAGAATAACAATTAATTCAACACTGAATAT
TTAACAATCAATTCAATAATCATTATTCAAATTTCAACAATCAATATTCAAAGATTCAAT
ATTGTATATTCAATATTTGTATCACAAAAACCGAACAAAAAAATTGCAAAATCAAAAAAC
ATTAAAATTACAATTTTCAGCCTTAAGCCTTTTAAAAGTTTTAAAGAAAAAATTAAGGGA
GTATAACCTGATTAAAAAGTAAATTTAAAATTACAGCTTTATGCCTTTATAAATGTGTTT
CTTAAAAAGTAAACCTTTAATATATTTTTTAAAGAATAAAAGAATCTGAATATAAGATCT
TCagaAATAGAGAAAAGTGGAAGACTACCTTACGGTCCTTACTGAAAACTTCGAG