>rJMCP002G03 652 bp,
ATGGGGGACGCTCAGCAAAGCTTGAAACTCTGTTCGACCCTGAGCCTGGGCTTTCGGTTG
TTTTCTCAGCAAAAcgaactttgtcatccaagtctcggatatcaactcttcctattccct
ttctttTTgaTTTATcaaatcatgggtggcTGCCTGATCTTcaccagcatcTTGAAgtGC
TTCTTTCTTGAGCTGTTCTATTTCTTTTTTCAAATTCTTTTCCTCATCTGTCTCAGGCCT
GAAGCATTTTTATCCCATCAATGAGATATTCTATATTTCTATTTCAACTTCCTTTTCCTA
CTTTATTTCCTTTGAAGGAGTAGAGAGGTTGAATTTTGATAATCAAATCATTCAAGaAAC
TTATCACACATAAGGAGTCATATAAGCAAATAGTAAATAAAACAGGACCAACAAGTATGT
GACTGTATACAATACCATTATATCTAtaagtTGTGTTGAACTGGTAAGTAATTATATCTA
GTAgggttaGGGCATGTTTTGTGTAGACtgTagacaaaggtgtaTGTCAGTATATTACTT
GTCGCTGTAT