>rJMCP002F12 647 bp,
TCATTGATGCTAACACTGGACGCTCCAAAGGTTATGGCTTTGTGAGGTTTGGCGATGATA
ATGAGAGGTCTCAGGCCTTGACTGAAATGAATGGCGTTTATTGTTCAAGCCGGCCTATGC
GAATTGGTGCAGCCACTCCCAGGAAATCATCGGGATATCAACAGCAATTTGCTGCACAAG
GTGGATATTCAAATGGTTCTCCAGCACAAGGGTCACAATCTGATGGCGATTCTTCTAATA
CCACGATTTTTGTTGGAGGTCTCGACCCAAATGTTAGTGACGAAGACCTTAGGCAGCCTT
TCTTACAATATGGTGAAGTAGTTTCTGTTAAAATTCCTGTTGGGAAAGGATGTGGATTTG
TGCAATTTGCTAAGAGAAATGACGCagaGGAAGCACTGCAGAAGTTGAAAGGTCTTGTGA
TCGGGAAACAGACAGTTCGCCTTTCTTGGGGACGAAATCCGGCTAATAAAGAGACAAGAG
GTGAGTTCATGAACCAGTGGACAGGGGCATACTATGGAGGACACTTCTAcaaTGGCTATG
GTTATGCTTTCC