>JMCP002E04 549 bp,
GGATTTCTCAAAGAGCAGCGAAGGGGCGCTGAAATGGGCCATTGATAACTTAGCTGATAA
GGGGGACACTTtctatatcatccacctccacccctcacgcctctaatgaatctcgcAATA
AGCTCTGGTCTCAATCCGGCTGTCCTTTGATTCCGCTGTCCGAGTTTCGCGAGCCTGAGT
TGTTGAAGAAGTACAATGTAAAGGCTAATATGGAAGTTCTCGATTTGCTTGATACCGCTA
CTAGGCagaAAGAGATAACCGTTGTTGCAAAATTGTACTGGGGTGATGCAAGAGAGAAAC
TCTGTGATTCAATTgaagatctgaagttggATtctcgggtTATGGGCAACAgaGGCCTTa
gcagcCTCCaGAGGATTATCATGGGAAGTGTGACCAACTATGTACTGACAACTGCAACCT
GCCCTATAACTGTGGTGAagcAtCcagaTTTTcacaaGCACTGATggaggaagAgagctg
ATGaaAagtgagtTgagtTCCAAACATGAA