>JMCP002D07 606 bp,:Filtered
ATCTTATACGGAGTAATTGCTAGACTAAACGGGTAAACCCTAGTACCCTATTGTTCCTAC
GCATCTCATTCTTCAACTCTTCGCAAATCGCAGCGACCCGCCGACGCCGCGAGGTTGGAC
GCCGGAAACTGGTCAGAAGCACAATAGTGATTCTTGTAAGATGGTTGTTTTTACAGCATT
CAATCGCCTTGCACCCAAAACCAAGAATCTTGTAGTTGCTGGAGGCTTGTCAGGATTTGT
CTTTGGGGTGTATTTCTACACCATGAGAGCTGTCGGAGGCACAGATGAACTTCAGATTGC
CATTGATAAGTTTGAACAGGAGAAACAGAACAAAGACACTAAAGCAAGTTTGGCATCAAA
TACATAATATCACTGTCATAGTTAGGAATAAGAAACTGTGGTCTTGGCAGGAGGAACAGA
AATGTCATCAGATTCTAGTTGTTAAAATAATGTTTTTGCTTTTAGACTCAAGTTTAATGT
TTTGTTGTAAATAAATCAAGATTCTGCATTTCCTTCCATGTTTACCTGAGAATATGATTC
TGAAATAAGAGTTCAGAGTTCTAGTG