>JMCP002C02 517 bp,:Filtered
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCaagGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCGTACGAGAATTCAAGAAACCAGTTC
AACAACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAAC
TACCagaATATGGAGGAGTTCCAGGACCAagaAGACCTTCCCTGaGATTCCTTAACAATT
TTTTTTTTTCTACAAAGTTAAAagaTGATCatgtgACGGagtCCCAAAATCTGCAAATTA
AACACACGActgGGTGTTTGATTgtgTGTTAAATTATGGTTGTTTAGGGGC