>JMCP002B02 167 bp,:Filtered
ACGGCCCTGCTCGGCCCCagaGATCCTCCTTTCCTCTGTTTTCTTTTCACTTTTTTAGTA
TGTTATATGGAAGTTTATTTTTATAAATTATAATCCATACCGCAATGATTGTTTGC