>rJMCP002B01 648 bp,
AGTACGACCTCAGCTCCGTCAAGTTGCTGGCATGCGGCGGCGCCCCGCTCGGAAGGGAGG
TCGCCGGACGGTTCAATGCCAGGTTCCCCAACGTGGATATTTCTCAGGGCTATGGTCTGA
CTGAGACAACCGGCGGGACAACGGGGATGATAAGTCCCGAGGAATGTCAAAAGTATGGTT
CTGCTGGCCGCATTAATTCAGTCGTGGAAGCTAAGATAGTCGATCCTGAAACTGGGGAAG
CATCGCCTCCTGGCCATCGTGGTGAGCTGTGGCTAcgaggGCCCTTAATCATGAAAGGGT
ATGTTGGCGACAGATCTGCCACTTCTGCAACATTaGATTCGGAAGGATGGCTAAGAACGG
GGGATCTCTGCTATTTCGACTCGGAAGGGTTCTTGTTTGTTGTGGACAGGTTGAAGGAAC
TAATCAAATACAAGGCCTTTCAGgTTCCCCCTGCTGAGTTAGAACATCTGCTTCAGTCAA
TCCCTGATGTTGCTGATGCCGCTGTTATTCCATTTCCTGATGAAGAagcaGGACAGATTC
CAATGGCCTATGTTGTGAGAAA