>JMCP002A06 636 bp,
ATCAAGCTGGTCAGGATGAAAAACCTCCATTACTGCTGAAAAGCCATGGAGGTCCTACAG
CTGAGGCGAGGGGAAGTTTGAATCTTAGTATTCAATATTGGACTAGTCGTGGCTGGGCAC
TTGTGGATGTGAACTATGGTGGAAGCACTGGTTATGGCAGAGAATTCCGAGAGAGGCTCT
TGAGGAACTGGGGAATAGTTGATGTTAATGACTGTTGCAGTTGTGCTAAGTTTTTGGTTG
ATAGTGGAAGGGTTGATGGTGAGCGGTTATGTATCACGGGAAGTTCAGcTGGCGGGTACA
CTACATTAGCAGCACTTGCATTCAAAGATGTATTCAAAGCTGGTTGTTCCTTATATGGTA
TAGGCGACCTGAAATTGCTGGTTGATGGAATGCCCAAGTTTGAATCTCACTATATCGACA
ATCTTGTTGGAGATAAAAATGCATACTTTGAGAGGTCTCCCATCAATTTTGTGGACAAAT
TTTCATGCCCCATAATTTTATTTCAAGGATTGGATGACAAGGTTGTCCCCCCAGAGCAAG
CACGCAAAATCTACCAAGCACTGAAGGCAAAAGGTTTACCTGTTGCCCTGGTGGAATATG
AAG